lenticrisprv2 puro vector (Addgene inc)
Addgene inc is a verified supplier 
98
Structured Review
Addgene inc
lenticrisprv2 puro vector
Lenticrisprv2 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 522 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrisprv2+puro+vector/lentiCRISPRv2+puro+(Plasmid+%2398290)/pmc13007490-34-8-10
Average 98 stars, based on 522 article reviews
Lenticrisprv2 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 522 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrisprv2+puro+vector/lentiCRISPRv2+puro+(Plasmid+%2398290)/pmc13007490-34-8-10
Average 98 stars, based on 522 article reviews
lenticrisprv2 puro vector - by Bioz Stars,
2026-10
98/100 stars
Images
Related Articles
Clone Assay:Article Title: A genetic screen for modifiers of cohesin clustering identifies regulators of genome folding Article Snippet: .. A previous publication identified two residues in WAPL (M1116 and Y725) essential for its function ( ). sgRNAs targeting these residues were individually cloned into the Article Title: Genome-wide CRISPR screens identify key regulators of adipogenesis and glucose uptake in beige adipocytes. Article Snippet: The beiging of white adipocytes enhances energy expenditure by utilizing fatty acids and glucose, offering therapeutic potential against obesity and type 2 diabetes.. However, the genetic mechanisms driving this process remain unclear.. Here, we performed multiple fluorescence-activated cell sorting (FACS)-based genome-wide CRISPR loss-of-function screens in beige adipocytes with or without insulin resistance (IR) induction, and systematically identified functional regulators of beige adipocyte adipogenesis and glucose metabolism. Article Title: SMARCA5 is required for the development of granule cell neuron precursors and Sonic Hedgehog Medulloblastoma growth Article Snippet: .. One sgRNA per Smo and Smarca5 was generated and cloned into Article Title: Single domain antibodies and their use in cancer therapies Article Snippet: .. Complementary single strand oligonucleotides encoding the sgRNA sequence for FGFR4 knockout (TTGCACATAGGGGAAACCGT) were annealed and cloned into the Article Title: A genetic screen for modifiers of cohesin clustering identifies regulators of genome folding. Article Snippet: .. Using this criteria, 26 NIPBL- like and 22 WAPL/PDS5- like hits were prioritized. sgRNA cloning and lentivirus production A previous publication identified two residues in WAPL (M1116 and Y725) essential for its function (20). sgRNAs targeting these residues were individually cloned into the Article Title: Caspase-8 drove apoptosis of BMECs to promote neutrophil infiltration and DE205B clearance in meningitis. Article Snippet: Avian pathogenic Escherichia coli (APEC), a significant virulence reservoir for human extraintestinal pathogenic E. coli (ExPEC), poses an escalating zoonotic risk through the food chain.. Our previous study demonstrated that the poultry-derived strain DE205B shared high genetic similarity with the neonatal meningitis-associated E. coli (NMEC) strain RS218 and induced meningitis in a rat model.. Here, we further demonstrated that DE205B crossed the blood-brain barrier (BBB) via a transcellular pathway without compromising barrier integrity. Plasmid Preparation:Article Title: A genetic screen for modifiers of cohesin clustering identifies regulators of genome folding Article Snippet: .. A previous publication identified two residues in WAPL (M1116 and Y725) essential for its function ( ). sgRNAs targeting these residues were individually cloned into the Article Title: Genome-wide CRISPR screens identify key regulators of adipogenesis and glucose uptake in beige adipocytes. Article Snippet: The beiging of white adipocytes enhances energy expenditure by utilizing fatty acids and glucose, offering therapeutic potential against obesity and type 2 diabetes.. However, the genetic mechanisms driving this process remain unclear.. Here, we performed multiple fluorescence-activated cell sorting (FACS)-based genome-wide CRISPR loss-of-function screens in beige adipocytes with or without insulin resistance (IR) induction, and systematically identified functional regulators of beige adipocyte adipogenesis and glucose metabolism. Article Title: SMARCA5 is required for the development of granule cell neuron precursors and Sonic Hedgehog Medulloblastoma growth Article Snippet: .. One sgRNA per Smo and Smarca5 was generated and cloned into Article Title: Single domain antibodies and their use in cancer therapies Article Snippet: .. Complementary single strand oligonucleotides encoding the sgRNA sequence for FGFR4 knockout (TTGCACATAGGGGAAACCGT) were annealed and cloned into the Article Title: A genetic screen for modifiers of cohesin clustering identifies regulators of genome folding. Article Snippet: .. Using this criteria, 26 NIPBL- like and 22 WAPL/PDS5- like hits were prioritized. sgRNA cloning and lentivirus production A previous publication identified two residues in WAPL (M1116 and Y725) essential for its function (20). sgRNAs targeting these residues were individually cloned into the Article Title: Depleting HIF-1α attenuates the progression of osteosarcoma, but tumorigenicity is sustained through HIF-independent pathways Article Snippet: .. The oligos were annealed and ligated into the Article Title: Caspase-8 drove apoptosis of BMECs to promote neutrophil infiltration and DE205B clearance in meningitis. Article Snippet: Avian pathogenic Escherichia coli (APEC), a significant virulence reservoir for human extraintestinal pathogenic E. coli (ExPEC), poses an escalating zoonotic risk through the food chain.. Our previous study demonstrated that the poultry-derived strain DE205B shared high genetic similarity with the neonatal meningitis-associated E. coli (NMEC) strain RS218 and induced meningitis in a rat model.. Here, we further demonstrated that DE205B crossed the blood-brain barrier (BBB) via a transcellular pathway without compromising barrier integrity. Generated:Article Title: SMARCA5 is required for the development of granule cell neuron precursors and Sonic Hedgehog Medulloblastoma growth Article Snippet: .. One sgRNA per Smo and Smarca5 was generated and cloned into Sequencing:Article Title: SMARCA5 is required for the development of granule cell neuron precursors and Sonic Hedgehog Medulloblastoma growth Article Snippet: .. One sgRNA per Smo and Smarca5 was generated and cloned into Article Title: Single domain antibodies and their use in cancer therapies Article Snippet: .. Complementary single strand oligonucleotides encoding the sgRNA sequence for FGFR4 knockout (TTGCACATAGGGGAAACCGT) were annealed and cloned into the Knock-Out:Article Title: Single domain antibodies and their use in cancer therapies Article Snippet: .. Complementary single strand oligonucleotides encoding the sgRNA sequence for FGFR4 knockout (TTGCACATAGGGGAAACCGT) were annealed and cloned into the Ligation:Article Title: Single domain antibodies and their use in cancer therapies Article Snippet: .. Complementary single strand oligonucleotides encoding the sgRNA sequence for FGFR4 knockout (TTGCACATAGGGGAAACCGT) were annealed and cloned into the Cloning:Article Title: A genetic screen for modifiers of cohesin clustering identifies regulators of genome folding. Article Snippet: .. Using this criteria, 26 NIPBL- like and 22 WAPL/PDS5- like hits were prioritized. sgRNA cloning and lentivirus production A previous publication identified two residues in WAPL (M1116 and Y725) essential for its function (20). sgRNAs targeting these residues were individually cloned into the |